Ff Gene 5 Single-Stranded DNA-Binding Protein Assembles on Nucleotides Constrained by a DNA Hairpin
Journal
Biochemistry
Journal Volume
43
Journal Issue
9
Pages
2622 - 2634
Date Issued
2004
Author(s)
Gray, Donald M.
Abstract
The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.
Type
journal article